Antibodies
Anti-RNF40 Antibody-Oligo Conjugate
SKU: aoc3325
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RNF40 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase BRE1B
- UniProt Number
- O75150
- Target Description
- Component of the RNF20/40 E3 ubiquitin-protein ligase complex that mediates monoubiquitination of 'Lys-120' of histone H2B (H2BK120ub1). H2BK120ub1 gives a specific tag for epigenetic transcriptional activation and is also prerequisite for histone H3 'Lys-4' and 'Lys-79' methylation (H3K4me and H3K79me, respectively). It thereby plays a central role in histone code and gene regulation. The RNF20/40 complex forms a H2B ubiquitin ligase complex in cooperation with the E2 enzyme UBE2A or UBE2B; reports about the cooperation with UBE2E1/UBCH are contradictory. Required for transcriptional activation of Hox genes.; FUNCTION: (Microbial infection) Promotes the human herpesvirus 8 (KSHV) lytic cycle by inducing the expression of lytic viral genes including the latency switch gene RTA/ORF50.
- Molecular Weight
- 114kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1651
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse