Antibodies
Anti-RNF7 Antibody-Oligo Conjugate
SKU: aoc3326
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RNF7 Antibody-IF1
Antibody Target
- Target
- RING-box protein 2
- UniProt Number
- Q9UBF6
- Target Description
- Catalytic component of multiple cullin-5-RING E3 ubiquitin-protein ligase complexes (ECS complexes), which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. It is thereby involved in various biological processes, such as cell cycle progression, signal transduction and transcription. The functional specificity of the E3 ubiquitin-protein ligase ECS complexes depend on the variable SOCS box-containing substrate recognition component. Within ECS complexes, RNF7/RBX2 recruits the E2 ubiquitination enzyme to the complex via its RING-type and brings it into close proximity to the substrate. Catalytic subunit of various SOCS-containing ECS complexes, such as the ECS(SOCS7) complex, that regulate reelin signaling by mediating ubiquitination and degradation of DAB1. The ECS(SOCS2) complex mediates the ubiquitination and subsequent proteasomal degradation of phosphorylated EPOR and GHR. Promotes ubiquitination and degradation of NF1, thereby regulating Ras protein signal transduction. As part of the ECS(ASB9) complex, catalyzes ubiquitination and degradation of CKB. The ECS(SPSB3) complex catalyzes ubiquitination of nuclear CGAS. As part of the ECS(RAB40C) complex, mediates ANKRD28 ubiquitination and degradation, thereby inhibiting protein phosphatase 6 (PP6) complex activity and focal adhesion assembly during cell migration. As part of some ECS complex, catalyzes 'Lys-11'-linked ubiquitination and degradation of BTRC. ECS complexes and ARIH2 collaborate in tandem to mediate ubiquitination of target proteins; ARIH2 mediating addition of the first ubiquitin on CRLs targets. Specifically catalyzes the neddylation of CUL5 via its interaction with UBE2F. Does not catalyze neddylation of other cullins (CUL1, CUL2, CUL3, CUL4A or CUL4B). May play a role in protecting cells from apoptosis induced by redox agents.; FUNCTION: [Isoform 2]: Inactive.; FUNCTION: (Microbial infection) Following infection by HIV-1 virus, catalytic component of a cullin-5-RING E3 ubiquitin-protein ligase complex (ECS complex) hijacked by the HIV-1 Vif protein, which catalyzes ubiquitination and degradation of APOBEC3F and APOBEC3G.
- Molecular Weight
- 13kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3065
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat