Antibodies
Anti-ROCK2 Antibody-Oligo Conjugate
SKU: aoc3329
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ROCK2 Antibody-IF1
Antibody Target
- Target
- Rho-associated protein kinase 2
- UniProt Number
- O75116
- Target Description
- Protein kinase which is a key regulator of actin cytoskeleton and cell polarity. Involved in regulation of smooth muscle contraction, actin cytoskeleton organization, stress fiber and focal adhesion formation, neurite retraction, cell adhesion and motility via phosphorylation of ADD1, BRCA2, CNN1, EZR, DPYSL2, EP300, MSN, MYL9/MLC2, NPM1, RDX, PPP1R12A and VIM. Phosphorylates SORL1 and IRF4. Acts as a negative regulator of VEGF-induced angiogenic endothelial cell activation. Positively regulates the activation of p42/MAPK1-p44/MAPK3 and of p90RSK/RPS6KA1 during myogenic differentiation. Plays an important role in the timely initiation of centrosome duplication. Inhibits keratinocyte terminal differentiation. May regulate closure of the eyelids and ventral body wall through organization of actomyosin bundles. Plays a critical role in the regulation of spine and synaptic properties in the hippocampus. Plays an important role in generating the circadian rhythm of the aortic myofilament Ca(2+) sensitivity and vascular contractility by modulating the myosin light chain phosphorylation.
- Molecular Weight
- 161kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0744
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat