Antibodies
Anti-RPS3 Antibody-Oligo Conjugate
SKU: aoc3345
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RPS3 Antibody-IF1
Antibody Target
- Target
- Small ribosomal subunit protein uS3
- UniProt Number
- P23396
- Target Description
- Component of the small ribosomal subunit. The ribosome is a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. Has endonuclease activity and plays a role in repair of damaged DNA. Cleaves phosphodiester bonds of DNAs containing altered bases with broad specificity and cleaves supercoiled DNA more efficiently than relaxed DNA. Displays high binding affinity for 7,8-dihydro-8-oxoguanine (8-oxoG), a common DNA lesion caused by reactive oxygen species (ROS). Has also been shown to bind with similar affinity to intact and damaged DNA. Stimulates the N-glycosylase activity of the base excision protein OGG1. Enhances the uracil excision activity of UNG1. Also stimulates the cleavage of the phosphodiester backbone by APEX1. When located in the mitochondrion, reduces cellular ROS levels and mitochondrial DNA damage. Has also been shown to negatively regulate DNA repair in cells exposed to hydrogen peroxide. Plays a role in regulating transcription as part of the NF-kappa-B p65-p50 complex where it binds to the RELA/p65 subunit, enhances binding of the complex to DNA and promotes transcription of target genes. Represses its own translation by binding to its cognate mRNA. Binds to and protects TP53/p53 from MDM2-mediated ubiquitination. Involved in spindle formation and chromosome movement during mitosis by regulating microtubule polymerization. Involved in induction of apoptosis through its role in activation of CASP8. Induces neuronal apoptosis by interacting with the E2F1 transcription factor and acting synergistically with it to up-regulate pro-apoptotic proteins BCL2L11/BIM and HRK/Dp5. Interacts with TRADD following exposure to UV radiation and induces apoptosis by caspase-dependent JNK activation.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0302
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat