Antibodies
Anti-RSK2 Antibody-Oligo Conjugate
SKU: aoc3349
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RSK2 Antibody-IF1
Antibody Target
- Target
- Ribosomal protein S6 kinase alpha-3
- UniProt Number
- P51812
- Target Description
- Serine/threonine-protein kinase that acts downstream of ERK (MAPK1/ERK2 and MAPK3/ERK1) signaling and mediates mitogenic and stress-induced activation of the transcription factors CREB1, ETV1/ER81 and NR4A1/NUR77, regulates translation through RPS6 and EIF4B phosphorylation, and mediates cellular proliferation, survival, and differentiation by modulating mTOR signaling and repressing pro-apoptotic function of BAD and DAPK1. In fibroblast, is required for EGF-stimulated phosphorylation of CREB1 and histone H3 at 'Ser-10', which results in the subsequent transcriptional activation of several immediate-early genes. In response to mitogenic stimulation (EGF and PMA), phosphorylates and activates NR4A1/NUR77 and ETV1/ER81 transcription factors and the cofactor CREBBP. Upon insulin-derived signal, acts indirectly on the transcription regulation of several genes by phosphorylating GSK3B at 'Ser-9' and inhibiting its activity. Phosphorylates RPS6 in response to serum or EGF via an mTOR-independent mechanism and promotes translation initiation by facilitating assembly of the preinitiation complex. In response to insulin, phosphorylates EIF4B, enhancing EIF4B affinity for the EIF3 complex and stimulating cap-dependent translation. Is involved in the mTOR nutrient-sensing pathway by directly phosphorylating TSC2 at 'Ser-1798', which potently inhibits TSC2 ability to suppress mTOR signaling, and mediates phosphorylation of RPTOR, which regulates mTORC1 activity and may promote rapamycin-sensitive signaling independently of the PI3K/AKT pathway. Mediates cell survival by phosphorylating the pro-apoptotic proteins BAD and DAPK1 and suppressing their pro-apoptotic function. Promotes the survival of hepatic stellate cells by phosphorylating CEBPB in response to the hepatotoxin carbon tetrachloride (CCl4). Is involved in cell cycle regulation by phosphorylating the CDK inhibitor CDKN1B, which promotes CDKN1B association with 14-3-3 proteins and prevents its translocation to the nucleus and inhibition of G1 progression. In LPS-stimulated dendritic cells, is involved in TLR4-induced macropinocytosis, and in myeloma cells, acts as effector of FGFR3-mediated transformation signaling, after direct phosphorylation at Tyr-529 by FGFR3. Negatively regulates EGF-induced MAPK1/3 phosphorylation via phosphorylation of SOS1. Phosphorylates SOS1 at 'Ser-1134' and 'Ser-1161' that create YWHAB and YWHAE binding sites and which contribute to the negative regulation of MAPK1/3 phosphorylation. Phosphorylates EPHA2 at 'Ser-897', the RPS6KA-EPHA2 signaling pathway controls cell migration. Acts as a regulator of osteoblast differentiation by mediating phosphorylation of ATF4, thereby promoting ATF4 transactivation activity.
- Molecular Weight
- 84kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2799
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat