Antibodies
Anti-RUNX2 Antibody-Oligo Conjugate
SKU: aoc3351
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-RUNX2 Antibody-PLA1
Antibody Target
- Target
- Runt-related transcription factor 2
- UniProt Number
- Q13950
- Target Description
- Transcription factor involved in osteoblastic differentiation and skeletal morphogenesis. Essential for the maturation of osteoblasts and both intramembranous and endochondral ossification. CBF binds to the core site, 5'-PYGPYGGT-3', of a number of enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers, osteocalcin, osteopontin, bone sialoprotein, alpha 1(I) collagen, LCK, IL-3 and GM-CSF promoters. In osteoblasts, supports transcription activation: synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the osteocalcin FGF-responsive element (OCFRE). Inhibits KAT6B-dependent transcriptional activation.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0362
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse