Antibodies
Anti-RUVBL1 Antibody-Oligo Conjugate
SKU: aoc3352
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RUVBL1 Antibody-IF1
Antibody Target
- Target
- RuvB-like 1
- UniProt Number
- Q9Y265
- Target Description
- Possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity; hexamerization is thought to be critical for ATP hydrolysis and adjacent subunits in the ring-like structure contribute to the ATPase activity. Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome-DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Component of a SWR1-like complex that specifically mediates the removal of histone H2A.Z/H2AZ1 from the nucleosome. Proposed core component of the chromatin remodeling INO80 complex which exhibits DNA- and nucleosome-activated ATPase activity and catalyzes ATP-dependent nucleosome sliding. Plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. Essential for cell proliferation. May be able to bind plasminogen at cell surface and enhance plasminogen activation.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISAChIP
- Clone
- ARC1247
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat