Antibodies
Anti-RXRA Antibody-Oligo Conjugate
SKU: aoc3353
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RXRA Antibody-IF1
Antibody Target
- Target
- Retinoic acid receptor RXR-alpha
- UniProt Number
- P19793
- Target Description
- Receptor for retinoic acid that acts as a transcription factor. Forms homo- or heterodimers with retinoic acid receptors (RARs) and binds to target response elements in response to their ligands, all-trans or 9-cis retinoic acid, to regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5 to regulate transcription. The high affinity ligand for retinoid X receptors (RXRs) is 9-cis retinoic acid. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone deacetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and coactivators are recruited leading to transcriptional activation. Serves as a common heterodimeric partner for a number of nuclear receptors, such as RARA, RARB and PPARA. The RXRA/RARB heterodimer can act as a transcriptional repressor or transcriptional activator, depending on the RARE DNA element context. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes. Together with RARA, positively regulates microRNA-10a expression, thereby inhibiting the GATA6/VCAM1 signaling response to pulsatile shear stress in vascular endothelial cells. Acts as an enhancer of RARA binding to RARE DNA element. May facilitate the nuclear import of heterodimerization partners such as VDR and NR4A1. Promotes myelin debris phagocytosis and remyelination by macrophages. Plays a role in the attenuation of the innate immune system in response to viral infections, possibly by negatively regulating the transcription of antiviral genes such as type I IFN genes. Involved in the regulation of calcium signaling by repressing ITPR2 gene expression, thereby controlling cellular senescence.
- Molecular Weight
- 51 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCChIPChIP-seqELISA
- Clone
- ARC0468
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat