Antibodies
Anti-S100P Antibody-Oligo Conjugate
SKU: aoc3365
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-S100P Antibody-IF1
Antibody Target
- Target
- Protein S100-P
- UniProt Number
- P25815
- Target Description
- May function as calcium sensor and contribute to cellular calcium signaling. In a calcium-dependent manner, functions by interacting with other proteins, such as EZR and PPP5C, and indirectly plays a role in physiological processes like the formation of microvilli in epithelial cells. May stimulate cell proliferation in an autocrine manner via activation of the receptor for activated glycation end products (RAGE).
- Molecular Weight
- 10kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC50711
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human