Antibodies
Anti-SAFB Antibody-Oligo Conjugate
SKU: aoc3370
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SAFB Antibody-IF1
Antibody Target
- Target
- Scaffold attachment factor B1
- UniProt Number
- Q15424
- Target Description
- Binds to scaffold/matrix attachment region (S/MAR) DNA and forms a molecular assembly point to allow the formation of a 'transcriptosomal' complex (consisting of SR proteins and RNA polymerase II) coupling transcription and RNA processing. Functions as an estrogen receptor corepressor and can also bind to the HSP27 promoter and decrease its transcription. Thereby acts as a negative regulator of cell proliferation. When associated with RBMX, binds to and stimulates transcription from the SREBF1 promoter.
- Molecular Weight
- 103kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2983
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat