Antibodies
Anti-SAMHD1 Antibody-Oligo Conjugate
SKU: aoc3373
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SAMHD1 Antibody-IF1
Antibody Target
- Target
- Deoxynucleoside triphosphate triphosphohydrolase SAMHD1
- UniProt Number
- Q9Y3Z3
- Target Description
- Protein that acts both as a host restriction factor involved in defense response to virus and as a regulator of DNA end resection at stalled replication forks. Has deoxynucleoside triphosphate (dNTPase) activity, which is required to restrict infection by viruses, such as HIV-1: dNTPase activity reduces cellular dNTP levels to levels too low for retroviral reverse transcription to occur, blocking early-stage virus replication in dendritic and other myeloid cells. Likewise, suppresses LINE-1 retrotransposon activity. Not able to restrict infection by HIV-2 virus; because restriction activity is counteracted by HIV-2 viral protein Vpx. In addition to virus restriction, dNTPase activity acts as a regulator of DNA precursor pools by regulating dNTP pools. Phosphorylation at Thr-592 acts as a switch to control dNTPase-dependent and -independent functions: it inhibits dNTPase activity and ability to restrict infection by viruses, while it promotes DNA end resection at stalled replication forks. Functions during S phase at stalled DNA replication forks to promote the resection of gapped or reversed forks: acts by stimulating the exonuclease activity of MRE11, activating the ATR-CHK1 pathway and allowing the forks to restart replication. Its ability to promote degradation of nascent DNA at stalled replication forks is required to prevent induction of type I interferons, thereby preventing chronic inflammation. Ability to promote DNA end resection at stalled replication forks is independent of dNTPase activity. Enhances immunoglobulin hypermutation in B-lymphocytes by promoting transversion mutation.
- Molecular Weight
- 72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1050
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human