Antibodies
Anti-SAMM50 Antibody-Oligo Conjugate
SKU: aoc3374
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SAMM50 Antibody-IF1
Antibody Target
- Target
- Sorting and assembly machinery component 50 homolog
- UniProt Number
- Q9Y512
- Target Description
- Plays a crucial role in the maintenance of the structure of mitochondrial cristae and the proper assembly of the mitochondrial respiratory chain complexes. Required for the assembly of TOMM40 into the TOM complex.
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2784
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat