Antibodies
Anti-SATB1 Antibody-Oligo Conjugate
SKU: aoc3386
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SATB1 Antibody-IF1
Antibody Target
- Target
- DNA-binding protein SATB1
- UniProt Number
- Q01826
- Target Description
- Crucial silencing factor contributing to the initiation of X inactivation mediated by Xist RNA that occurs during embryogenesis and in lymphoma. Binds to DNA at special AT-rich sequences, the consensus SATB1-binding sequence (CSBS), at nuclear matrix- or scaffold-associated regions. Thought to recognize the sugar-phosphate structure of double-stranded DNA. Transcriptional repressor controlling nuclear and viral gene expression in a phosphorylated and acetylated status-dependent manner, by binding to matrix attachment regions (MARs) of DNA and inducing a local chromatin-loop remodeling. Acts as a docking site for several chromatin remodeling enzymes (e.g. PML at the MHC-I locus) and also by recruiting corepressors (HDACs) or coactivators (HATs) directly to promoters and enhancers. Modulates genes that are essential in the maturation of the immune T-cell CD8SP from thymocytes. Required for the switching of fetal globin species, and beta- and gamma-globin genes regulation during erythroid differentiation. Plays a role in chromatin organization and nuclear architecture during apoptosis. Interacts with the unique region (UR) of cytomegalovirus (CMV). Alu-like motifs and SATB1-binding sites provide a unique chromatin context which seems preferentially targeted by the HIV-1 integration machinery. Moreover, HIV-1 Tat may overcome SATB1-mediated repression of IL2 and IL2RA (interleukin) in T-cells by binding to the same domain than HDAC1. Delineates specific epigenetic modifications at target gene loci, directly up-regulating metastasis-associated genes while down-regulating tumor-suppressor genes. Reprograms chromatin organization and the transcription profiles of breast tumors to promote growth and metastasis. Promotes neuronal differentiation of neural stem/progenitor cells in the adult subventricular zone, possibly by positively regulating the expression of NEUROD1.
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC56265
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat