Antibodies
Anti-SATB2 Antibody-Oligo Conjugate (ARC2363)
SKU: aoc3387
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SATB2 Antibody (ARC2363)-IF1
Antibody Target
- Target
- DNA-binding protein SATB2
- UniProt Number
- Q9UPW6
- Target Description
- Binds to DNA, at nuclear matrix- or scaffold-associated regions. Thought to recognize the sugar-phosphate structure of double-stranded DNA. Transcription factor controlling nuclear gene expression, by binding to matrix attachment regions (MARs) of DNA and inducing a local chromatin-loop remodeling. Acts as a docking site for several chromatin remodeling enzymes and also by recruiting corepressors (HDACs) or coactivators (HATs) directly to promoters and enhancers. Required for the initiation of the upper-layer neurons (UL1) specific genetic program and for the inactivation of deep-layer neurons (DL) and UL2 specific genes, probably by modulating BCL11B expression. Repressor of Ctip2 and regulatory determinant of corticocortical connections in the developing cerebral cortex. May play an important role in palate formation. Acts as a molecular node in a transcriptional network regulating skeletal development and osteoblast differentiation.
- Molecular Weight
- 83 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC2363
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat