Antibodies
Anti-SCD1 Antibody-Oligo Conjugate
SKU: aoc3390
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCD1 Antibody-IF1
Antibody Target
- Target
- Stearoyl-CoA desaturase
- UniProt Number
- O00767
- Target Description
- Stearoyl-CoA desaturase that utilizes O(2) and electrons from reduced cytochrome b5 to introduce the first double bond into saturated fatty acyl-CoA substrates. Catalyzes the insertion of a cis double bond at the delta-9 position into fatty acyl-CoA substrates including palmitoyl-CoA and stearoyl-CoA. Gives rise to a mixture of 16:1 and 18:1 unsaturated fatty acids. Plays an important role in lipid biosynthesis. Plays an important role in regulating the expression of genes that are involved in lipogenesis and in regulating mitochondrial fatty acid oxidation. Plays an important role in body energy homeostasis. Contributes to the biosynthesis of membrane phospholipids, cholesterol esters and triglycerides.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC68650
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human