AntibodiesNeuroMab
Anti-SCN1A Antibody-Oligo Conjugate
SKU: aoc17
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN1A Antibody-IF1
Antibody Target
- Target
- SCN1A
- UniProt Number
- P35498
- Target Description
- Nav1.1 Na+ channel (sodium channel, voltage-gated, type I, alpha subunit/ SCN1A) is a member of voltage-gated sodium ion channel subunit family. It is encoded by gene Scn1a in human.The channel switches between open and close conformation in response to the voltage difference accross the membrane. Nav1.1 Na+ channel is a sodium selective channel that maintains Na+ homeostasis by allowing Na+ ions to pass in accordance of their electrochemical gradient. The protein plays an important role in the release of neurotransmittors from the neurons. Therefore, Nav1.1 Na+ channel is involved in the perception of mechanical pain due to the activation of sematosensory neurons without the involvement of inflammation. Mutation of the gene encoding for Nav1.1 Na+ channel is one of the main cause of epilepsy and febrile seizures.
- Molecular Weight
- 220 kDa
- Synonyms
- Sodium channel protein type 1 subunit alpha (Sodium channel protein brain I subunit alpha) (Sodium channel protein type I subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Specificity
- No cross-reactivity with Nav1.2Nav1.3 and Nav1.6
- Clone
- K74/71
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1929-2009 (cytoplasmic C-terminus) of rat Nav1.1 (accession number P04774) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMonkey (Non-Human Primate)MouseRat