AntibodiesNeuroMab
Anti-SCN1A Antibody-Oligo Conjugate
SKU: aoc17
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN1A Antibody-IF1
Antibody Target
- Target
- SCN1A
- UniProt Number
- P35498
- Target Description
- Pore-forming subunit of Nav1.1, a voltage-gated sodium (Nav) channel that directly mediates the depolarizing phase of action potentials in excitable membranes. Navs, also called VGSCs (voltage-gated sodium channels) or VDSCs (voltage-dependent sodium channels), operate by switching between closed and open conformations depending on the voltage difference across the membrane. In the open conformation they allow Na(+) ions to selectively pass through the pore, along their electrochemical gradient. The influx of Na(+) ions provokes membrane depolarization, initiating the propagation of electrical signals throughout cells and tissues. By regulating the excitability of neurons, ensures that they respond appropriately to synaptic inputs, maintaining the balance between excitation and inhibition in brain neural circuits. Nav1.1 plays a role in controlling the excitability and action potential propagation from somatosensory neurons, thereby contributing to the sensory perception of mechanically-induced pain.
- Molecular Weight
- 220 kDa
- Synonyms
- Sodium channel protein type 1 subunit alpha (Sodium channel protein brain I subunit alpha) (Sodium channel protein type I subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Specificity
- No cross-reactivity with Nav1.2Nav1.3 and Nav1.6
- Clone
- K74/71
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1929-2009 (cytoplasmic C-terminus) of rat Nav1.1 (accession number P04774) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMonkey (Non-Human Primate)MouseRat