AntibodiesNeuroMab
Anti-SCN8A Antibody-Oligo Conjugate
SKU: aoc18
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN8A Antibody-IF1
Antibody Target
- Target
- SCN8A
- UniProt Number
- Q9UQD0
- Target Description
- Pore-forming subunit of a voltage-gated sodium channel complex assuming opened or closed conformations in response to the voltage difference across membranes and through which sodium ions selectively pass along their electrochemical gradient. Contributes to neuronal excitability by regulating action potential threshold and propagation.; FUNCTION: [Isoform 5]: More specifically expressed in non-neuronal cells, could play a role in sodium release from intracellular compartments and participate in the control of podosomes formation and macrophages adhesion and movement.
- Molecular Weight
- <200 kDa
- Synonyms
- Sodium channel protein type 8 subunit alpha (Peripheral nerve protein type 4) (PN4) (Sodium channel 6) (NaCh6) (Sodium channel protein type VIII subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.6)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- K87A/10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide 459-476 (intracellular interdomain loop I-II) of rat Nav1.6 (accession number O88420)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat