AntibodiesNeuroMab
Anti-SCN9A Antibody-Oligo Conjugate
SKU: aoc11
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SCN9A Antibody-IF1
Antibody Target
- Target
- SCN9A
- UniProt Number
- Q15858
- Target Description
- Nav1.7 subunit alpha, or SCN9A, is a member of the voltage gated sodium channel family. It is expressed at the terminal ends of sensory neurons in the dorsal root ganglion (DRG) and in trigeminal and sympathetic ganglion neurons. A major function of Nav1.7 is the generation and conduction of action potentials in nociceptors, or “pain receptors” and thus involved in pain sensation. Changes in Nav1.7 expression have been linked to primary erythermalgia, primary erythermalgia, and Congenital insensitivity to pain
- Molecular Weight
- 230 kDa
- Synonyms
- Sodium channel protein type 9 subunit alpha (Neuroendocrine sodium channel) (hNE-Na) (Peripheral sodium channel 1) (PN1) (Sodium channel protein type IX subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.7)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity against other Nav channels
- Clone
- N68/6
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1751-1946 (cytoplasmic C-terminus) of human Nav1.7 (accession number Q15858) produced recombinantly in E. Coli
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat