Antibodies
Anti-SDHA Antibody-Oligo Conjugate
SKU: aoc3391
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SDHA Antibody-IF1
Antibody Target
- Target
- Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial
- UniProt Number
- P31040
- Target Description
- Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). SDH also oxidizes malate to the non-canonical enol form of oxaloacetate, enol-oxaloacetate. Enol-oxaloacetate, which is a potent inhibitor of the succinate dehydrogenase activity, is further isomerized into keto-oxaloacetate. Can act as a tumor suppressor.
- Molecular Weight
- 73 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC0726
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat