Antibodies
Anti-SESN1 Antibody-Oligo Conjugate
SKU: aoc3407
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SESN1 Antibody-IF1
Antibody Target
- Target
- Sestrin-1
- UniProt Number
- Q9Y6P5
- Target Description
- Functions as an intracellular leucine sensor that negatively regulates the TORC1 signaling pathway through the GATOR complex. In absence of leucine, binds the GATOR subcomplex GATOR2 and prevents TORC1 signaling. Binding of leucine to SESN2 disrupts its interaction with GATOR2 thereby activating the TORC1 signaling pathway. This stress-inducible metabolic regulator may also play a role in protection against oxidative and genotoxic stresses. May positively regulate the transcription by NFE2L2 of genes involved in the response to oxidative stress by facilitating the SQSTM1-mediated autophagic degradation of KEAP1. Moreover, may prevent the accumulation of reactive oxygen species (ROS) through the alkylhydroperoxide reductase activity born by the N-terminal domain of the protein. Was originally reported to contribute to oxidative stress resistance by reducing PRDX1. However, this could not be confirmed.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2313
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse