Antibodies
Anti-SET Antibody-Oligo Conjugate
SKU: aoc3409
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SET Antibody-IF1
Antibody Target
- Target
- Protein SET
- UniProt Number
- Q01105
- Target Description
- Multitasking protein, involved in apoptosis, transcription, nucleosome assembly and histone chaperoning. Isoform 2 anti-apoptotic activity is mediated by inhibition of the GZMA-activated DNase, NME1. In the course of cytotoxic T-lymphocyte (CTL)-induced apoptosis, GZMA cleaves SET, disrupting its binding to NME1 and releasing NME1 inhibition. Isoform 1 and isoform 2 are potent inhibitors of protein phosphatase 2A. Isoform 1 and isoform 2 inhibit EP300/CREBBP and PCAF-mediated acetylation of histones (HAT) and nucleosomes, most probably by masking the accessibility of lysines of histones to the acetylases. The predominant target for inhibition is histone H4. HAT inhibition leads to silencing of HAT-dependent transcription and prevents active demethylation of DNA. Both isoforms stimulate DNA replication of the adenovirus genome complexed with viral core proteins; however, isoform 2 specific activity is higher.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC1462
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat