Antibodies
Anti-SF3B3 Antibody-Oligo Conjugate
SKU: aoc3416
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SF3B3 Antibody-IF1
Antibody Target
- Target
- Splicing factor 3B subunit 3
- UniProt Number
- Q15393
- Target Description
- Component of the 17S U2 SnRNP complex of the spliceosome, a large ribonucleoprotein complex that removes introns from transcribed pre-mRNAs. The 17S U2 SnRNP complex (1) directly participates in early spliceosome assembly and (2) mediates recognition of the intron branch site during pre-mRNA splicing by promoting the selection of the pre-mRNA branch-site adenosine, the nucleophile for the first step of splicing. Within the 17S U2 SnRNP complex, SF3B3 is part of the SF3B subcomplex, which is required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence in pre-mRNA. Sequence independent binding of SF3A and SF3B subcomplexes upstream of the branch site is essential, it may anchor U2 snRNP to the pre-mRNA. May also be involved in the assembly of the 'E' complex. Also acts as a component of the minor spliceosome, which is involved in the splicing of U12-type introns in pre-mRNAs.
- Molecular Weight
- 136kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1667
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat