Antibodies
Anti-SFRP4 Antibody-Oligo Conjugate
SKU: aoc3419
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SFRP4 Antibody-IF1
Antibody Target
- Target
- Secreted frizzled-related protein 4
- UniProt Number
- Q6FHJ7
- Target Description
- Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types. SFRP4 plays a role in bone morphogenesis. May also act as a regulator of adult uterine morphology and function. May also increase apoptosis during ovulation possibly through modulation of FZ1/FZ4/WNT4 signaling. Has phosphaturic effects by specifically inhibiting sodium-dependent phosphate uptake.
- Molecular Weight
- 40 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0923
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat