Antibodies
Anti-SFT Antibody-Oligo Conjugate
SKU: aoc3420
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SFT Antibody-IF1
Antibody Target
- Target
- Ubiquitin-conjugating enzyme E2 D1
- UniProt Number
- P51668
- Target Description
- Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-48'-linked polyubiquitination. Mediates the selective degradation of short-lived and abnormal proteins. Functions in the E6/E6-AP-induced ubiquitination of p53/TP53. Mediates ubiquitination of PEX5 and auto-ubiquitination of STUB1, TRAF6 and TRIM63/MURF1. Ubiquitinates STUB1-associated HSP90AB1 in vitro. Lacks inherent specificity for any particular lysine residue of ubiquitin. Essential for viral activation of IRF3. Mediates polyubiquitination of CYP3A4.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2935
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat