Antibodies
Anti-SHARPIN Antibody-Oligo Conjugate
SKU: aoc3424
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SHARPIN Antibody-IF1
Antibody Target
- Target
- Sharpin
- UniProt Number
- Q9H0F6
- Target Description
- Component of the LUBAC complex which conjugates linear polyubiquitin chains in a head-to-tail manner to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF-induced cell death and thereby prevents inflammation. LUBAC is recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. The LUBAC complex is also involved in innate immunity by conjugating linear polyubiquitin chains at the surface of bacteria invading the cytosol to form the ubiquitin coat surrounding bacteria. LUBAC is not able to initiate formation of the bacterial ubiquitin coat, and can only promote formation of linear polyubiquitins on pre-existing ubiquitin. The bacterial ubiquitin coat acts as an 'eat-me' signal for xenophagy and promotes NF-kappa-B activation. Together with OTULIN, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC64384
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat