Antibodies
Anti-SHIP1 Antibody-Oligo Conjugate
SKU: aoc3426
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SHIP1 Antibody-IF1
Antibody Target
- Target
- Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 1
- UniProt Number
- Q92835
- Target Description
- Phosphatidylinositol (PtdIns) phosphatase that specifically hydrolyzes the 5-phosphate of phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3) to produce PtdIns(3,4)P2, thereby negatively regulating the PI3K (phosphoinositide 3-kinase) pathways. Able also to hydrolyzes the 5-phosphate of phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P3) and inositol 1,3,4,5-tetrakisphosphate. Acts as a negative regulator of B-cell antigen receptor signaling. Mediates signaling from the FC-gamma-RIIB receptor (FCGR2B), playing a central role in terminating signal transduction from activating immune/hematopoietic cell receptor systems. Acts as a negative regulator of myeloid cell proliferation/survival and chemotaxis, mast cell degranulation, immune cells homeostasis, integrin alpha-IIb/beta-3 signaling in platelets and JNK signaling in B-cells. Regulates proliferation of osteoclast precursors, macrophage programming, phagocytosis and activation and is required for endotoxin tolerance. Involved in the control of cell-cell junctions, CD32a signaling in neutrophils and modulation of EGF-induced phospholipase C activity. Key regulator of neutrophil migration, by governing the formation of the leading edge and polarization required for chemotaxis. Modulates FCGR3/CD16-mediated cytotoxicity in NK cells. Mediates the activin/TGF-beta-induced apoptosis through its Smad-dependent expression.
- Molecular Weight
- 133kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2047
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat