Antibodies
Anti-SHP1 Antibody-Oligo Conjugate
SKU: aoc3427
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SHP1 Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein phosphatase non-receptor type 6
- UniProt Number
- P29350
- Target Description
- Tyrosine phosphatase enzyme that plays important roles in controlling immune signaling pathways and fundamental physiological processes such as hematopoiesis. Dephosphorylates and negatively regulate several receptor tyrosine kinases (RTKs) such as EGFR, PDGFR and FGFR, thereby modulating their signaling activities. When recruited to immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptors such as immunoglobulin-like transcript 2/LILRB1, programmed cell death protein 1/PDCD1, CD3D, CD22, CLEC12A and other receptors involved in immune regulation, initiates their dephosphorylation and subsequently inhibits downstream signaling events. Modulates the signaling of several cytokine receptors including IL-4 receptor. Additionally, targets multiple cytoplasmic signaling molecules including STING1, LCK or STAT1 among others involved in diverse cellular processes including modulation of T-cell activation or cGAS-STING signaling. Within the nucleus, negatively regulates the activity of some transcription factors such as NFAT5 via direct dephosphorylation. Also acts as a key transcriptional regulator of hepatic gluconeogenesis by controlling recruitment of RNA polymerase II to the PCK1 promoter together with STAT5A.
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0295
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat