Antibodies
Anti-SHP2 Antibody-Oligo Conjugate
SKU: aoc3428
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SHP2 Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein phosphatase non-receptor type 11
- UniProt Number
- Q06124
- Target Description
- Acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. Positively regulates MAPK signal transduction pathway. Dephosphorylates GAB1, ARHGAP35 and EGFR. Dephosphorylates ROCK2 at 'Tyr-722' resulting in stimulation of its RhoA binding activity. Dephosphorylates CDC73. Dephosphorylates SOX9 on tyrosine residues, leading to inactivate SOX9 and promote ossification. Dephosphorylates tyrosine-phosphorylated NEDD9/CAS-L.
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2635
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat