Antibodies
Anti-SIN3A Antibody-Oligo Conjugate (ARC0745)
SKU: aoc3431
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SIN3A Antibody (ARC0745)-IF1
Antibody Target
- Target
- Paired amphipathic helix protein Sin3a
- UniProt Number
- Q96ST3
- Target Description
- Acts as a transcriptional repressor. Corepressor for REST. Interacts with MXI1 to repress MYC responsive genes and antagonize MYC oncogenic activities. Also interacts with MXD1-MAX heterodimers to repress transcription by tethering SIN3A to DNA. Acts cooperatively with OGT to repress transcription in parallel with histone deacetylation. Involved in the control of the circadian rhythms. Required for the transcriptional repression of circadian target genes, such as PER1, mediated by the large PER complex through histone deacetylation. Cooperates with FOXK1 to regulate cell cycle progression probably by repressing cell cycle inhibitor genes expression. Required for cortical neuron differentiation and callosal axon elongation.
- Molecular Weight
- 145kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC0745
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat