Antibodies
Anti-SKP1 Antibody-Oligo Conjugate
SKU: aoc3437
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SKP1 Antibody-IF1
Antibody Target
- Target
- S-phase kinase-associated protein 1
- UniProt Number
- P63208
- Target Description
- Essential component of the SCF (SKP1-CUL1-F-box protein) ubiquitin ligase complex, which mediates the ubiquitination of proteins involved in cell cycle progression, signal transduction and transcription. In the SCF complex, serves as an adapter that links the F-box protein to CUL1. The functional specificity of the SCF complex depends on the F-box protein as substrate recognition component. SCF(BTRC) and SCF(FBXW11) direct ubiquitination of CTNNB1 and participate in Wnt signaling. SCF(FBXW11) directs ubiquitination of phosphorylated NFKBIA. SCF(BTRC) directs ubiquitination of NFKBIB, NFKBIE, ATF4, SMAD3, SMAD4, CDC25A, FBXO5, CEP68 and probably NFKB2. SCF(SKP2) directs ubiquitination of phosphorylated CDKN1B/p27kip and is involved in regulation of G1/S transition. SCF(SKP2) directs ubiquitination of ORC1, CDT1, RBL2, ELF4, CDKN1A, RAG2, FOXO1A, and probably MYC and TAL1. SCF(FBXW7) directs ubiquitination of cyclin E, NOTCH1 released notch intracellular domain (NICD), and probably PSEN1. SCF(FBXW2) directs ubiquitination of GCM1. SCF(FBXO32) directs ubiquitination of MYOD1. SCF(FBXO7) directs ubiquitination of BIRC2 and DLGAP5. SCF(FBXO33) directs ubiquitination of YBX1. SCF(FBXO11) directs ubiquitination of BCL6 and DTL but does not seem to direct ubiquitination of TP53. SCF(BTRC) mediates the ubiquitination of NFKBIA at 'Lys-21' and 'Lys-22'; the degradation frees the associated NFKB1-RELA dimer to translocate into the nucleus and to activate transcription. SCF(CCNF) directs ubiquitination of CCP110. SCF(FBXL3) and SCF(FBXL21) direct ubiquitination of CRY1 and CRY2. SCF(FBXO9) directs ubiquitination of TTI1 and TELO2. SCF(FBXO10) directs ubiquitination of BCL2. Core component of the Cul7-RING(FBXW8) ubiquitin ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Also acts as a core component of the Cul1-RING(FBXL4) ubiquitin ligase complex, which mediates the ubiquitination and subsequent proteasomal degradation of BNIP3 and BNI3L.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1384
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat