Antibodies
Anti-SKP2 Antibody-Oligo Conjugate
SKU: aoc3438
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SKP2 Antibody-IF1
Antibody Target
- Target
- S-phase kinase-associated protein 2
- UniProt Number
- Q13309
- Target Description
- Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins involved in cell cycle progression, signal transduction and transcription. Specifically recognizes phosphorylated CDKN1B/p27kip and is involved in regulation of G1/S transition. Degradation of CDKN1B/p27kip also requires CKS1. Recognizes target proteins ORC1, CDT1, RBL2, KMT2A/MLL1, CDK9, RAG2, NBN, FOXO1, UBP43, YTHDF2, and probably MYC, TOB1 and TAL1. Degradation of TAL1 also requires STUB1. Recognizes CDKN1A in association with CCNE1 or CCNE2 and CDK2. Promotes ubiquitination and destruction of CDH1 in a CK1-dependent manner, thereby regulating cell migration. Following phosphorylation in response to DNA damage, mediates 'Lys-63'-linked ubiquitination of NBN, promoting ATM recruitment to DNA damage sites and DNA repair via homologous recombination.; FUNCTION: Through the ubiquitin-mediated proteasomal degradation of hepatitis C virus non-structural protein 5A, has an antiviral activity towards that virus.
- Molecular Weight
- 48 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0886
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human