Antibodies
Anti-SLC14A1 Antibody-Oligo Conjugate
SKU: aoc3441
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SLC14A1 Antibody-IF1
Antibody Target
- Target
- Urea transporter 1
- UniProt Number
- Q13336
- Target Description
- Mediates the transport of urea driven by a concentration gradient across the cell membrane of erythrocytes. Also mediates the transport of urea across the cell membrane of the renal inner medullary collecting duct which is critical to the urinary concentrating mechanism. Facilitates water transport in erythrocytes.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC60284
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse