Antibodies
Anti-SLC22A3/OCT3 Antibody-Oligo Conjugate
SKU: aoc3443
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SLC22A3/OCT3 Antibody-IF1
Antibody Target
- Target
- Solute carrier family 22 member 3
- UniProt Number
- O75751
- Target Description
- Electrogenic voltage-dependent transporter that mediates the transport of a variety of organic cations such as endogenous bioactive amines, cationic drugs and xenobiotics. Cation cellular uptake or release is driven by the electrochemical potential, i.e. membrane potential and concentration gradient. Functions as a Na(+)- and Cl(-)-independent, bidirectional uniporter. Implicated in monoamine neurotransmitters uptake such as dopamine, adrenaline/epinephrine, noradrenaline/norepinephrine, histamine, serotonin and tyramine, thereby supporting a role in homeostatic regulation of aminergic neurotransmission in the brain. Transports dopaminergic neuromodulators cyclo(his-pro) and salsolinol with low efficiency. May be involved in the uptake and disposition of cationic compounds by renal clearance from the blood flow. May contribute to regulate the transport of cationic compounds in testis across the blood-testis-barrier (Probable). Mediates the transport of polyamine spermidine and putrescine. Mediates the bidirectional transport of polyamine agmatine. Also transports guanidine. May also mediate intracellular transport of organic cations, thereby playing a role in amine metabolism and intracellular signaling.
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2285
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse