Antibodies
Anti-Slit2 Antibody-Oligo Conjugate
SKU: aoc3448
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Slit2 Antibody-IF1
Antibody Target
- Target
- Slit homolog 2 protein
- UniProt Number
- O94813
- Target Description
- Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal cord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal cord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. In vitro, Slit homolog 2 protein N-product, but not Slit homolog 2 protein C-product, repels olfactory bulb (OB) but not dorsal root ganglia (DRG) axons, induces OB growth cones collapse and induces branching of DRG axons. Seems to be involved in regulating leukocyte migration.
- Molecular Weight
- 170 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2010
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat