Antibodies
Anti-Smad1 Antibody-Oligo Conjugate (ARC0365)
SKU: aoc3452
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Smad1 Antibody (ARC0365)-IF1
Antibody Target
- Target
- Mothers against decapentaplegic homolog 1
- UniProt Number
- Q15797
- Target Description
- Transcriptional modulator that plays a role in various cellular processes, including embryonic development, cell differentiation, and tissue homeostasis. Upon BMP ligand binding to their receptors at the cell surface, is phosphorylated by activated type I BMP receptors (BMPRIs) and associates with SMAD4 to form a heteromeric complex which translocates into the nucleus acting as transcription factor. In turn, the hetero-trimeric complex recognizes cis-regulatory elements containing Smad Binding Elements (SBEs) to modulate the outcome of the signaling network. SMAD1/OAZ1/PSMB4 complex mediates the degradation of the CREBBP/EP300 repressor SNIP1. Positively regulates BMP4-induced expression of odontogenic development regulator MSX1 following IPO7-mediated nuclear import.
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0365
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse