Antibodies
Anti-Smad2 Antibody-Oligo Conjugate
SKU: aoc3453
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Smad2 Antibody-IF1
Antibody Target
- Target
- Mothers against decapentaplegic homolog 2
- UniProt Number
- Q15796
- Target Description
- Receptor-regulated SMAD (R-SMAD) that is an intracellular signal transducer and transcriptional modulator activated by TGF-beta (transforming growth factor) and activin type 1 receptor kinases. Binds the TRE element in the promoter region of many genes that are regulated by TGF-beta and, on formation of the SMAD2/SMAD4 complex, activates transcription. Promotes TGFB1-mediated transcription of odontoblastic differentiation genes in dental papilla cells. Positively regulates PDPK1 kinase activity by stimulating its dissociation from the 14-3-3 protein YWHAQ which acts as a negative regulator. May act as a tumor suppressor in colorectal carcinoma.
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0343
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat