Antibodies
Anti-Smad3 Antibody-Oligo Conjugate (ARC0490)
SKU: aoc3455
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Smad3 Antibody (ARC0490)-IF1
Antibody Target
- Target
- Mothers against decapentaplegic homolog 3
- UniProt Number
- P84022
- Target Description
- Receptor-regulated SMAD (R-SMAD) that is an intracellular signal transducer and transcriptional modulator activated by TGF-beta (transforming growth factor) and activin type 1 receptor kinases. Binds the TRE element in the promoter region of many genes that are regulated by TGF-beta and, on formation of the SMAD3/SMAD4 complex, activates transcription. Also can form a SMAD3/SMAD4/JUN/FOS complex at the AP-1/SMAD site to regulate TGF-beta-mediated transcription. Has an inhibitory effect on wound healing probably by modulating both growth and migration of primary keratinocytes and by altering the TGF-mediated chemotaxis of monocytes. This effect on wound healing appears to be hormone-sensitive. Regulator of chondrogenesis and osteogenesis and inhibits early healing of bone fractures. Positively regulates PDPK1 kinase activity by stimulating its dissociation from the 14-3-3 protein YWHAQ which acts as a negative regulator.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC0490
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human