Antibodies
Anti-SMARCA2 Antibody-Oligo Conjugate
SKU: aoc3457
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SMARCA2 Antibody-IF1
Antibody Target
- Target
- SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 2
- UniProt Number
- P51531
- Target Description
- ATPase involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth.
- Molecular Weight
- 181kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPChIPELISA
- Clone
- ARC59944
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 201-300 of human SMARCA2 (NP_003061.3).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human