Antibodies
Anti-SMARCAD1 Antibody-Oligo Conjugate
SKU: aoc3458
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SMARCAD1 Antibody-IF1
Antibody Target
- Target
- SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A containing DEAD/H box 1
- UniProt Number
- Q9H4L7
- Target Description
- DNA helicase that possesses intrinsic ATP-dependent nucleosome-remodeling activity and is both required for DNA repair and heterochromatin organization. Promotes DNA end resection of double-strand breaks (DSBs) following DNA damage: probably acts by weakening histone DNA interactions in nucleosomes flanking DSBs. Required for the restoration of heterochromatin organization after replication. Acts at replication sites to facilitate the maintenance of heterochromatin by directing H3 and H4 histones deacetylation, H3 'Lys-9' trimethylation (H3K9me3) and restoration of silencing.
- Molecular Weight
- 68 kDa/117 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC68058
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat