Antibodies
Anti-SMC1A Antibody-Oligo Conjugate
SKU: aoc3463
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SMC1A Antibody-IF1
Antibody Target
- Target
- Structural maintenance of chromosomes protein 1A
- UniProt Number
- Q14683
- Target Description
- Involved in chromosome cohesion during cell cycle and in DNA repair. Central component of cohesin complex. The cohesin complex is required for the cohesion of sister chromatids after DNA replication. The cohesin complex apparently forms a large proteinaceous ring within which sister chromatids can be trapped. At anaphase, the complex is cleaved and dissociates from chromatin, allowing sister chromatids to segregate. The cohesin complex may also play a role in spindle pole assembly during mitosis. Involved in DNA repair via its interaction with BRCA1 and its related phosphorylation by ATM, or via its phosphorylation by ATR. Works as a downstream effector both in the ATM/NBS1 branch and in the ATR/MSH2 branch of S-phase checkpoint.
- Molecular Weight
- 143kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1095
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse