Antibodies
Anti-SMN Antibody-Oligo Conjugate
SKU: aoc3467
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SMN Antibody-IF1
Antibody Target
- Target
- Survival motor neuron protein
- UniProt Number
- Q16637
- Target Description
- The SMN complex catalyzes the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome, and thereby plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP (Sm core). In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. To assemble core snRNPs, the SMN complex accepts the trapped 5Sm proteins from CLNS1A forming an intermediate. Within the SMN complex, SMN1 acts as a structural backbone and together with GEMIN2 it gathers the Sm complex subunits. Binding of snRNA inside 5Sm ultimately triggers eviction of the SMN complex, thereby allowing binding of SNRPD3 and SNRPB to complete assembly of the core snRNP. Ensures the correct splicing of U12 intron-containing genes that may be important for normal motor and proprioceptive neurons development. Also required for resolving RNA-DNA hybrids created by RNA polymerase II, that form R-loop in transcription terminal regions, an important step in proper transcription termination. May also play a role in the metabolism of small nucleolar ribonucleoprotein (snoRNPs).
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1710
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat