Antibodies
Anti-SMPD3/NSMase2 Antibody-Oligo Conjugate
SKU: aoc3468
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SMPD3/NSMase2 Antibody-IF1
Antibody Target
- Target
- Sphingomyelin phosphodiesterase 3
- UniProt Number
- Q9NY59
- Target Description
- Catalyzes the hydrolysis of sphingomyelin to form ceramide and phosphocholine. Ceramide mediates numerous cellular functions, such as apoptosis and growth arrest, and is capable of regulating these 2 cellular events independently. Also hydrolyzes sphingosylphosphocholine. Regulates the cell cycle by acting as a growth suppressor in confluent cells. Probably acts as a regulator of postnatal development and participates in bone and dentin mineralization. Binds to anionic phospholipids (APLs) such as phosphatidylserine (PS) and phosphatidic acid (PA) that modulate enzymatic activity and subcellular location. May be involved in IL-1-beta-induced JNK activation in hepatocytes. May act as a mediator in transcriptional regulation of NOS2/iNOS via the NF-kappa-B activation under inflammatory conditions.
- Molecular Weight
- 71kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC60887
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat