Antibodies
Anti-SND1 Antibody-Oligo Conjugate
SKU: aoc3471
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SND1 Antibody-IF1
Antibody Target
- Target
- Staphylococcal nuclease domain-containing protein 1
- UniProt Number
- Q7KZF4
- Target Description
- Endonuclease that mediates miRNA decay of both protein-free and AGO2-loaded miRNAs. As part of its function in miRNA decay, regulates mRNAs involved in G1-to-S phase transition. Functions as a bridging factor between STAT6 and the basal transcription factor. Plays a role in PIM1 regulation of MYB activity. Functions as a transcriptional coactivator for STAT5.; FUNCTION: (Microbial infection) Functions as a transcriptional coactivator for the Epstein-Barr virus nuclear antigen 2 (EBNA2).; FUNCTION: (Microbial infection) Promotes SARS-CoV-2 RNA synthesis by binding to negative-sense RNA and the viral protein nsp9.
- Molecular Weight
- 102kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC68115
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat