Antibodies
Anti-SNF2H Antibody-Oligo Conjugate
SKU: aoc3472
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SNF2H Antibody-IF1
Antibody Target
- Target
- SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5
- UniProt Number
- O60264
- Target Description
- ATPase that possesses intrinsic ATP-dependent nucleosome-remodeling activity. Catalytic subunit of ISWI chromatin-remodeling complexes, which form ordered nucleosome arrays on chromatin and facilitate access to DNA during DNA-templated processes such as DNA replication, transcription, and repair; this may require intact histone H4 tails. Within the ISWI chromatin-remodeling complexes, slides edge- and center-positioned histone octamers away from their original location on the DNA template. Catalytic activity and histone octamer sliding propensity is regulated and determined by components of the ISWI chromatin-remodeling complexes. The BAZ1A/ACF1-, BAZ1B/WSTF-, BAZ2A/TIP5- and BAZ2B-containing ISWI chromatin-remodeling complexes regulate the spacing of nucleosomes along the chromatin and have the ability to slide mononucleosomes to the center of a DNA template in an ATP-dependent manner. The CECR2- and RSF1-containing ISWI chromatin-remodeling complexes do not have the ability to slide mononucleosomes to the center of a DNA template. Binds to core histones together with RSF1, and is required for the assembly of regular nucleosome arrays by the RSF-5 ISWI chromatin-remodeling complex. Involved in DNA replication and together with BAZ1A/ACF1 is required for replication of pericentric heterochromatin in S-phase. Probably plays a role in repression of RNA polymerase I dependent transcription of the rDNA locus, through the recruitment of the SIN3/HDAC1 corepressor complex to the rDNA promoter. Essential component of the WICH-5 ISWI chromatin-remodeling complex (also called the WICH complex), a chromatin-remodeling complex that mobilizes nucleosomes and reconfigures irregular chromatin to a regular nucleosomal array structure. The WICH-5 ISWI chromatin-remodeling complex regulates the transcription of various genes, has a role in RNA polymerase I transcription. Within the B-WICH complex has a role in RNA polymerase III transcription. Mediates the histone H2AX phosphorylation at 'Tyr-142', and is involved in the maintenance of chromatin structures during DNA replication processes. Essential component of NoRC-5 ISWI chromatin-remodeling complex, a complex that mediates silencing of a fraction of rDNA by recruiting histone-modifying enzymes and DNA methyltransferases, leading to heterochromatin formation and transcriptional silencing.
- Molecular Weight
- 122kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0795
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat