Antibodies
Anti-SNX5 Antibody-Oligo Conjugate
SKU: aoc3476
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SNX5 Antibody-IF1
Antibody Target
- Target
- Sorting nexin-5
- UniProt Number
- Q9Y5X3
- Target Description
- Involved in several stages of intracellular trafficking. Interacts with membranes containing phosphatidylinositol 3-phosphate (PtdIns(3P)) or phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2). Acts in part as component of the retromer membrane-deforming SNX-BAR subcomplex. The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX-BAR subcomplex functions to deform the donor membrane into a tubular profile called endosome-to-TGN transport carrier (ETC) (Probable). Does not have in vitro vesicle-to-membrane remodeling activity. Involved in retrograde transport of lysosomal enzyme receptor IGF2R. May function as link between endosomal transport vesicles and dynactin (Probable). Plays a role in the internalization of EGFR after EGF stimulation (Probable). Involved in EGFR endosomal sorting and degradation; the function involves PIP5K1C isoform 3 and is retromer-independent. Together with PIP5K1C isoform 3 facilitates HGS interaction with ubiquitinated EGFR, which initiates EGFR sorting to intraluminal vesicles (ILVs) of the multivesicular body for subsequent lysosomal degradation (Probable). Involved in E-cadherin sorting and degradation; inhibits PIP5K1C isoform 3-mediated E-cadherin degradation. Plays a role in macropinocytosis.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2985
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat