Antibodies
Anti-SOCS2 Antibody-Oligo Conjugate
SKU: aoc3477
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SOCS2 Antibody-IF1
Antibody Target
- Target
- Suppressor of cytokine signaling 2
- UniProt Number
- O14508
- Target Description
- Substrate-recognition component of a cullin-5-RING E3 ubiquitin-protein ligase complex (ECS complex, also named CRL5 complex), which mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as EPOR and GHR. Specifically recognizes and binds phosphorylated proteins via its SH2 domain, promoting their ubiquitination. The ECS(SOCS2) complex acts as a key regulator of growth hormone receptor (GHR) levels by mediating ubiquitination and degradation of GHR, following GHR phosphorylation by JAK2. The ECS(SOCS2) also catalyzes ubiquitination and degradation of JAK2-phosphorylated EPOR.
- Molecular Weight
- 22 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1470
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat