Antibodies
Anti-Somatostatin Antibody-Oligo Conjugate
SKU: aoc3481
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Somatostatin Antibody-IF1
Antibody Target
- Target
- Somatostatin
- UniProt Number
- P61278
- Target Description
- [Somatostatin-14]: Inhibits the secretion of pituitary hormones, including that of growth hormone/somatotropin (GH1), PRL, ACTH, luteinizing hormone (LH) and TSH. Also impairs ghrelin- and GnRH-stimulated secretion of GH1 and LH; the inhibition of ghrelin-stimulated secretion of GH1 can be further increased by neuronostatin.; FUNCTION: [Neuronostatin]: May enhance low-glucose-induced glucagon release by pancreatic alpha cells. This effect may be mediated by binding to GPR107 and PKA activation. May regulate cardiac contractile function. May compromise cardiomyocyte viability. In the central nervous system, may impair memory retention and may affect hippocampal excitability. May also have anxiolytic and anorexigenic effects. May play a role in arterial pressure regulation. May inhibit basal, but not ghrelin- or GnRH-stimulated secretion of GH1 or LH, but does not affect the release of other pituitary hormones, including PRL, ACTH, FSH or TSH. Potentiates inhibitory action of somatostatin on ghrelin-stimulated secretion of GH1, but not that on GnRH-stimulated secretion of LH.
- Molecular Weight
- 13kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC50670
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat