Antibodies
Anti-Sonic Hedgehog Antibody-Oligo Conjugate
SKU: aoc3482
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Sonic Hedgehog Antibody-IF1
Antibody Target
- Target
- Sonic hedgehog protein
- UniProt Number
- Q15465
- Target Description
- [Sonic hedgehog protein]: The C-terminal part of the sonic hedgehog protein precursor displays an autoproteolysis and a cholesterol transferase activity. Both activities result in the cleavage of the full-length protein into two parts (ShhN and ShhC) followed by the covalent attachment of a cholesterol moiety to the C-terminal of the newly generated ShhN. Both activities occur in the endoplasmic reticulum. Once cleaved, ShhC is degraded in the endoplasmic reticulum.; FUNCTION: [Sonic hedgehog protein N-product]: The dually lipidated sonic hedgehog protein N-product (ShhNp) is a morphogen which is essential for a variety of patterning events during development. Induces ventral cell fate in the neural tube and somites. Involved in the patterning of the anterior-posterior axis of the developing limb bud. Essential for axon guidance. Binds to the patched (PTCH1) receptor, which functions in association with smoothened (SMO), to activate the transcription of target genes. In the absence of SHH, PTCH1 represses the constitutive signaling activity of SMO.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC0701
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat