Antibodies
Anti-SOX10 Antibody-Oligo Conjugate (ARC1767)
SKU: aoc3486
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SOX10 Antibody (ARC1767)-IF1
Antibody Target
- Target
- Transcription factor SOX-10
- UniProt Number
- P56693
- Target Description
- Transcription factor that plays a central role in developing and mature glia. Specifically activates expression of myelin genes, during oligodendrocyte (OL) maturation, such as DUSP15 and MYRF, thereby playing a central role in oligodendrocyte maturation and CNS myelination. Once induced, MYRF cooperates with SOX10 to implement the myelination program. Transcriptional activator of MITF, acting synergistically with PAX3. Transcriptional activator of MBP, via binding to the gene promoter.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1767
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat