Antibodies
Anti-SP1 Antibody-Oligo Conjugate
SKU: aoc3490
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SP1 Antibody-IF1
Antibody Target
- Target
- Transcription factor Sp1
- UniProt Number
- P08047
- Target Description
- Transcription factor that can activate or repress transcription in response to physiological and pathological stimuli. Binds with high affinity to GC-rich motifs and regulates the expression of a large number of genes involved in a variety of processes such as cell growth, apoptosis, differentiation and immune responses. Highly regulated by post-translational modifications (phosphorylations, sumoylation, proteolytic cleavage, glycosylation and acetylation). Also binds the PDGFR-alpha G-box promoter. May have a role in modulating the cellular response to DNA damage. Implicated in chromatin remodeling. Plays an essential role in the regulation of FE65 gene expression. In complex with ATF7IP, maintains telomerase activity in cancer cells by inducing TERT and TERC gene expression. Isoform 3 is a stronger activator of transcription than isoform 1. Positively regulates the transcription of the core clock component BMAL1. Plays a role in the recruitment of SMARCA4/BRG1 on the c-FOS promoter. Plays a role in protecting cells against oxidative stress following brain injury by regulating the expression of RNF112.
- Molecular Weight
- 81kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISAChIPChIP-seqCUT&Tag
- Clone
- ARC0128
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat